

KEVIN DUERINCK WEBPAGE
GENETIC DEFINITIONS
[Revised August 20, 2003]
Allele: One of the different forms of a gene or DNA sequence that can exist at a single locus. Alternatively, one of several alternate forms of a gene occupying a particular location on a chromosome.
Atlantic Modal Haplotype (AMH): a haplotype consisting of the following markers and alleles, as frequently seen in Europe:
AMH definition:
Chromosomes: are composed of DNA, which itself is composed of 4 nucleotides: A (adenine), T (thymine), C (cytosine) and G (guanine).
Cohen Modal Haplotype (CMH):
Clone: To make multiple identical copies of a DNA sequence.
DNA: stands for deoxyribonucleic acid. A molecule made out of two strands that are tied together by hydrogen bonds; each strand being made up of a sugar, a phosphate group and one of four bases (adenine, guanine, cytosine or thymine).
DYS: Stands for D = DNA, Y = Y-chromosome, S = segment (segment in y-DNA testing means Short Tandem Repeat). A marker on chromosome 1 would be D1Snnn. Markers which are found on both the X and Y chromosome are DXYSnnn. The numbers after the DYS are arbitrary numbers, assigned in the order that they were discovered. From Ann Turner: "A marker on chromosome 1 would be D1Snnn. Markers which are found on both the X and Y chromosome are DXYSnnn. The numbers after the DYS are arbitrary numbers, assigned in the order that they were discovered." The DYS numbering scheme (e.g. DYS388, DYS390) for the Y-STR haplotype loci is controlled and administered by an international standards body called HUGO Human Gene Nomenclature Committee based at University College, London.
Electrophoresis: A technique for arranging biological particles across a gel medium by exposing them to an electric field.
Gene: The fundamental physical and functional unit of heredity, which carries information from one generation to the next; a segment of DNA, composed of a transcribed region and a regulatory sequence that makes transcription possible.
Generation: The average interval of time between the birth of parents and the birth of their offspring. For purposes of DNA testing, one lab (FTDNA) uses 20 years, and others appear to be hovering around 25 years. Some people have found that in their families a generation could be about 30 years. When you are trying to estimate the time to the most recent common ancestor (MRCA), the results will differ depending on the number of years used for a generation.
Genetic code: The set of correspondences between nucleotide pair triplets in DNA and amino acids in protein.
Genetic Markers: Alleles of genes, or DNA polymorphisms, used as experimental probes to keep track of an individual, a tissue, a cell, a nucleus, a chromosome, or a gene. Stated another way, any character that acts as a signpost or signal of the presence or location of a gene or heredity characteristic in an individual in a population.
There are 4 chromosome changes that do occur from generation to generation, and these are known as markers:
--indels: these are insertions or deletions of the DNA at particular locations on the chromosome. An example is the YAP (Y chromosome Alu Polymorphism).
--snips (SNP's): these are single nucleotide polymorphisms in which a particular nucleotide is changed (like A is changed to G). Since snips and indels (stable alus) are very rare, they also are known as unique event polymorphisms (UEPs).
--microsatellites: these are short sequences of nucleotides (generally 4 nucleotides: an example is GATA, where, for example, the nucleotide guanine is represented by "G") which are repeated over and over again a number of times in tandem; they are generally 2 to 5 nucleotides long. Changes sometimes do occur, however, and the number of repeats found at an allele may increase or decrease.
--minisatellites: these are longer sequences of nucleotides which are repeated over and over again a number of times in tandem. They are greater than 5 repeats long and more likely are 10 to 60 base pairs in length. The number of repeats often extends to several dozen. An example of a Y chromosome mini repeat is CACAATATACATGATGTATATTATA (Type 1). Changes sometimes do occur, however, and the number of repeats may increase or decrease. The Y has only one useful minisatellite, MSY1. All of its repeat variations are 25 bases long.
For markers and their ranges, see NIST STR database
Genome: The total genetic material of an organism, i.e. an organism's complete set of DNA sequences.
Genotype: The actual alleles present in an individual; the genetic makeup of an organism.
Haplogroup: "Distinct Y chromosomes, defined solely on the basis of unique mutation events (UME) character states, are designated as haplogroups." Each haplogroup consists of a variable number of Y chromosomes that share the same UME character state but vary in Y-STR haplotype.(from Peter de Knijff). More generally, haplogroup can be defined as a cluster of similar haplotypes. See "Lineages" below.
Wilson's paper (Helgason's were slightly different) gives the "modal" haplotype (the single most common haplotype) for his set of subjects in haplogroups 1, 2, and 3 (the most common European haplogroups):
_______hg1_hg2_hg3
DYS388_12__14__12
DYS393_13__13__13
DYS392_13__11__11
DYS19__14__14__16
DYS390_24__22__25
DYS391_11__10__11
Above modal haplotypes, see Wilson's study.
If your results match one of the above patterns, or differ in just one marker, we feel some confidence in classifying your haplogroup. For a list of haplogroups, see Y Chromosome Consortium [Y chromosome haplogroup tree and nomenclature]
Haplotype: "Distinct Y chromosomes identified by STR's are designated as haplotypes. Stated in another way: a haplotype is represented by the number of repeats at certain alleles, or markers on the y chromosome." (from Peter de Knijff)
Haplotype: A set of closely linked alleles (genes or DNA polymorphisms) inherited as a unit. A contraction of the phrase "haploid genotype." Different combinations of polymorphisms are known as haplotypes.
Lineages: "Y chromosomes that are defined by the combination of UMEs [haplogroups]and STRs [haplotypes] are called lineages." (from Peter de Knijff).
Locus: A specific location on a chromosome. Alternatively, the position on a chromosome at which the gene for a particular trait resides.
Markers: (see "Genetic markers" above)
Melungeon: DNA test results on Melungeons was released in late June 2002 by Dr. Kevin Jones of the Univ. of Virginia at Wise. These tests showed that Melungeon descendants had 5 percent African ancestry and 5 percent Native American ancestry, with the other 90 percent ancestry from Euroasia. Melungeons are a people of apparent Mediterranean descent who may have settled in the Appalachian wilderness in America. The Mediterrean includes areas of North Africa, southern Europe and Central Asia.
mtDNA: Mitochondrial DNA is DNA found in a mitochondrion. Mitochondria are organelles, if you will, that harness the majority of the usable energy from a simple sugar molecule. Individual mtDNA molecules are small and usually circular. Mitochondrial genomes are also characterized by a very high mutation rate.
Note: It has always been assumed that mtDNA is inherited by sons and daughters only from the mother. A new 2002 study [Marianne Schwartz and John Vissing from the University Hospital Rigshospitalet in Copenhagen, Denmark; New England Journal of Medicine (vol 347, p576)] showed that mtDNA can be inherited by both parents. This is believed to be extremely rare and should not interfere with mtDNA testing. We await confirmation from other scientific studies. See Paternal mtDNA
Multiplexing: Using the PCR reaction, the process of amplifying the a number of different loci in the sample.
Mutation: A disruption in the normal sequence of a DNA strand resulting in a different trait produced.
Phenotype: The visible characteristics of an organism.
Point mutation: A change in a single base pair.
Polymerase Chain Reaction: (PCR) A method of DNA analysis that amplifies a specific DNA (gene) region allowing rapid DNA analysis.
Polymorphic site: A chromosome site with two or more identifiable alleleic DNA sequences. Also called a polymorphic locus.
Polymorphism: a term to show that mutations do occur in the Y chromosome, as can happen with other chromosomes. It is a naturally occurring or induced variation in the sequence of genetic information on a segment of DNA.
STR: short tandem repeats. A VNTR (see below) in which the repeated sequence is from 1 to 5 base pairs.
UEP: Unique Event Polymorphism--the y-chromosome mutates at an allele.
UME: Unique Mutation Event (from Peter de Knijff)--same as Unique Event Polymorphism
VNTR: variable number tandem repeats. A defined region of DNA containing multiple copies of short sequences of bases which are repeated a number of times; the number of repeats varying among individuals in the population.
YCAII: a highly polymorphic dinucleotide repeat locus now known as DYS413. Sometimes this is shown as YCAIIa and YCAIIb. I assume also that you would see DYS413a and DYS413b.
YGATA: YGATA A7.1 is now designated and known as DYS460, a tetranucleotide (polymorphic) locus. YGATA A7.2 is now DYS461. YGATA A4 is now DYS439. Other polymorphic loci are YGATA H4, YGATA A8, YGATA A10 and YGATA C4.
Nat'l Human Genome Research Institute's Glossary
Genetics and Genealogy -- Y Polymorphism and mtDNA Analyses
Genetics Laboratories and Testing Sites
Medical Genetics and Genealogy--Genetic Diseases
Illinois Genetic Information Privacy Act
Short Tandem Repeat (STR) Analysis
Genetics and Human Migration Patterns (Genetic Anthropology)
For articles, bibliographies, research, please see Suggested Reading
Copyright © 2000-2003 Kevin F. Duerinck
Animated double helix DNA symbol courtesy of Webpromotion